SubtiBank SubtiBank
yuxJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yuxJ

similar to multidrug-efflux transporter
locus
BSU_31480
pI
10.45
mw
42.89 kDa
protein length
392 aa Sequence Blast
gene length
1179 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yugC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,232,640 3,233,818

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A8F58C3283116F6E8B455EB7FE5A2607D896C94A|yuxJ]
    description
    [Pubmed|21815947]

    additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B551 (yuxJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1550 NBRP B. subtilis, Japan]
  • BKE31480 ([gene|A8F58C3283116F6E8B455EB7FE5A2607D896C94A|yuxJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATGACAAAGTTTTTCT, downstream forward: _UP4_TGATTCCGAGAAAAAACTAA
  • BKK31480 ([gene|A8F58C3283116F6E8B455EB7FE5A2607D896C94A|yuxJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATGACAAAGTTTTTCT, downstream forward: _UP4_TGATTCCGAGAAAAAACTAA
  • References

  • 21815947