The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yuxJ

similar to multidrug-efflux transporter

locus: BSU_31480

pI: 10.45

mw: 42.89 kDa

protein length: 392 aa

gene length: 1179 bp

function: unknown

product: unknown

essential: no

synonyms: yugC

Genomic Context

categories

• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 3,232,640 3,233,818

The protein

Protein family

• [SW|major facilitator superfamily] (according to UniProt)

[SW|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|A8F58C3283116F6E8B455EB7FE5A2607D896C94A|yuxJ]
  description: [Pubmed|21815947]

  additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]

Biological materials

Mutant

• MGNA-B551 (yuxJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1550 NBRP B. subtilis, Japan]
• BKE31480 ([gene|A8F58C3283116F6E8B455EB7FE5A2607D896C94A|yuxJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATGACAAAGTTTTTCT, downstream forward: _UP4_TGATTCCGAGAAAAAACTAA
• BKK31480 ([gene|A8F58C3283116F6E8B455EB7FE5A2607D896C94A|yuxJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATGACAAAGTTTTTCT, downstream forward: _UP4_TGATTCCGAGAAAAAACTAA

References

• 21815947