SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


class A penicillin-binding protein 1A/1B, contributes to cell elongation and [SW|cell division]
99.36 kDa
protein length
914 aa Sequence Blast
gene length
2745 bp Sequence Blast
bifunctional glucosyltransferase/ transpeptidase
penicillin-binding protein 1A/1B, member of the [SW|divisome]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Penicillin-binding proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,341,444 2,344,188

    Phenotypes of a mutant

  • prevents bulging of the cells when grown at low Mg(2 ) concentrations, suppresses the lethal effect of a [gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB] mutation [Pubmed|19192185]
  • deletion of [gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA] restores growth and normal shape of a [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutant on gluconeogenic carbon sources [Pubmed|21320184]
  • a strain lacking all four class A [SW|penicillin-binding proteins] ([gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA] [gene|E50D4B30C2A0987A356C988AF8A4951C0CDF6C06|pbpD] [gene|73275060537497E6A9859856C9F040763E36316B|pbpF] [gene|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|pbpG]) is severely inhibited for L-form switching in the presence of D-cycloserine [pubmed|29456081]
  • The protein

    Catalyzed reaction/ biological activity

  • [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)](n)-diphospho-di-trans,octa-cis-undecaprenol + β-D-GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)-diphospho-di-trans,octa-cis-undecaprenol --> [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)](n+1)-diphospho-di-trans-octa-cis-undecaprenol + di-trans,octa-cis-undecaprenyl diphosphate + H+ (according to UniProt)
  • Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)
  • Protein family

  • N-terminal part: [SW|glycosyltransferase 51 family] (according to UniProt)
  • C-terminal part: [SW|transpeptidase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E50D4B30C2A0987A356C988AF8A4951C0CDF6C06|PbpD], [protein|73275060537497E6A9859856C9F040763E36316B|PbpF], [protein|BDC2D775CCE7C06F5619BAC214F29CFC637FE804|PbpG]
  • [SW|Domains]

  • Fibronectin type-III (aa 708-795) (according to UniProt)
  • Structure

  • [PDB|3DWK] (from Staphylococcus aureus, aa 71 ... 656, 38% identity) [pubmed|18760285]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • anchored to the membrane, the major part is exposed to the outside (according to UniProt)
  • localizes to the spore septum during sporulation [Pubmed|15758244,15262952]
  • during vegetative growth: septal, low flourescence at periphery [pubmed|14731276]
  • localizes to the vegetative septum [Pubmed|15262952], this depends on [protein|7150BABA5086D5E2EB8102E4901A216F43576282|GlmR] [Pubmed|21320184]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22211522], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive during vegetative growth [Pubmed|15758244]
  • view in new tab

    Biological materials


  • BKE22320 ([gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATCTCAACCTTTCG, downstream forward: _UP4_TAAACAAAAAAGCCGTCACC
  • BKK22320 ([gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATCTCAACCTTTCG, downstream forward: _UP4_TAAACAAAAAAGCCGTCACC
  • GFP fusion

  • 2083 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]::pSG1492 (cat Pxyl-gfpa-[gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|ponA]1-394) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [ BGSC]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jeff Errington] lab
  • labs

  • [SW|Jeff Errington], Newcastle University, UK [ homepage]
  • References


  • 21371139
  • Original publications

  • 8606187,15262952,9721295,10322023,7814321,18363795,14731276,21320184,18763711,19192185,18179421,23531131,18363795,18760285,29456081,30651563