SubtiBank SubtiBank
purR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

purR

transcription repressor of the pur operon
locus
BSU00470
pI
5.77
mw
31.08 kDa
protein length
285 aa Sequence Blast
gene length
858 bp Sequence Blast
function
regulation of purine biosynthesis
product
transcription repressor of the pur operon
essential
no
synonyms
yabI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    54,441 55,298

    The protein

    Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • Effectors of protein activity

  • PRPP acts as inducer, binding results in release of PurR from the operator [Pubmed|10919400]
  • Structure

  • [PDB|1O57], 1O57 [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?uid=25670 NCBI] [Pubmed|12837783]
  • Additional information

  • requires [protein|285D9E676B06119F9F4D33FC62615EC844D35BC3|YabJ] for ''in vivo'' activity
  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000112 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|8FA635D1915108BF29A864AF4DA28ECF633F735F|ispE]-[gene|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]-[gene|285D9E676B06119F9F4D33FC62615EC844D35BC3|yabJ]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, [Pubmed|7638212], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • negative autoregulation [Pubmed|7638212]
  • view in new tab

    Biological materials

    Mutant

  • BKE00470 ([gene|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACTCACCCCCAAAAT, downstream forward: _UP4_TTAAAGAATGGAGAGACAGA
  • BKK00470 ([gene|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAACTCACCCCCAAAAT, downstream forward: _UP4_TTAAAGAATGGAGAGACAGA
  • References

    Reviews

  • 28031352
  • Original publications

  • 10368157,14594850,15629952,11591660,12837783,7638212,12837784,19446032,10919400