SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


component of the BsuM DNA restriction system, similar to 5-methylcytosine-specific restriction enzyme
39.88 kDa
protein length
343 aa Sequence Blast
gene length
1032 bp Sequence Blast
BsuM DNA restriction

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.4|DNA restriction/ modification]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • Gene

    660,596 661,627

    The protein

    Catalyzed reaction/ biological activity

  • Endonucleolytic cleavage of DNA to give specific double-stranded fragments with terminal 5'-phosphates (according to UniProt)
  • Structure

  • [PDB|6HZ4] (5-methylcytosine-specific restriction enzyme from E. coli, corresponds to aa 29 ... 223, 29% identity) [pubmed|31296862]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C208 (ydiS::erm), available at the [ NBRP B. subtilis, Japan]
  • DELTA0 (''ydiS trpC2''), available at BGSC
  • BKE06100 ([gene|A8C606348C8C6FC3BB9786C06C9BFE9D3519A041|ydiS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGTTCATTTCCCCTAT, downstream forward: _UP4_TCGTCTTTTGTGAGTGATTA
  • BKK06100 ([gene|A8C606348C8C6FC3BB9786C06C9BFE9D3519A041|ydiS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGTTCATTTCCCCTAT, downstream forward: _UP4_TCGTCTTTTGTGAGTGATTA
  • References

  • 11751814,22092861,31296862