SubtiBank SubtiBank
ycgH [2018-09-13 18:40:19]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycgH [2018-09-13 18:40:19]

similar to amino acid transporter
locus
BSU03110
pI
9.25
mw
41.01 kDa
protein length
377 aa Sequence Blast
gene length
1131 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    336,092 → 337,432

    The protein

    Protein family

  • [APC superfamily of transport proteins|search|amino acid, polyamine, organocation (APC) superfamily of transporters], [http://www.tcdb.org/search/result.php?tc=2.A.3 TC 2.A.3]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B989 (ycgH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1988 NBRP B. subtilis, Japan]
  • BKE03110 (Δ[gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTATTCAACCCCTT, downstream forward: _UP4_AAAGATCGCCCTGCCAGTCC
  • BKK03110 (Δ[gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTATTCAACCCCTT, downstream forward: _UP4_AAAGATCGCCCTGCCAGTCC
  • References

  • 22383849