SubtiBank SubtiBank
ycgH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycgH

similar to amino acid transporter
locus
BSU03110
pI
9.25
mw
41.01 kDa
protein length
446 aa Sequence Blast
gene length
1341 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    336,092 337,432

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt) [http://www.tcdb.org/search/result.php?tc=2.A.3 TC 2.A.3]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B989 (ycgH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1988 NBRP B. subtilis, Japan]
  • BKE03110 ([gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTATTCAACCCCTT, downstream forward: _UP4_AAAGATCGCCCTGCCAGTCC
  • BKK03110 ([gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTATTCAACCCCTT, downstream forward: _UP4_AAAGATCGCCCTGCCAGTCC
  • References

  • 22383849