SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to amino acid transporter
41.01 kDa
protein length
446 aa Sequence Blast
gene length
1341 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    336,092 337,432

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt) [ TC 2.A.3]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation




  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials


  • MGNA-B989 (ycgH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03110 ([gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTATTCAACCCCTT, downstream forward: _UP4_AAAGATCGCCCTGCCAGTCC
  • BKK03110 ([gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTATTCAACCCCTT, downstream forward: _UP4_AAAGATCGCCCTGCCAGTCC
  • References

  • 22383849