SubtiBank SubtiBank
ycgH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycgH

similar to amino acid transporter
locus
BSU_03110
pI
9.25
mw
41.01 kDa
protein length
446 aa Sequence Blast
gene length
1341 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    336,092 337,432

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt) [http://www.tcdb.org/search/result.php?tc=2.A.3 TC 2.A.3]
  • Structure

  • [PDB|6F2G] (from Carnobacterium sp., corresponds to aa 23 ... 230, 24.8% identity) [pubmed|31000719]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B989 (ycgH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1988 NBRP B. subtilis, Japan]
  • BKE03110 ([gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTATTCAACCCCTT, downstream forward: _UP4_AAAGATCGCCCTGCCAGTCC
  • BKK03110 ([gene|A8BDF98B66A2DC044FD60ED9CA15AD70B0840B87|ycgH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTATTCAACCCCTT, downstream forward: _UP4_AAAGATCGCCCTGCCAGTCC
  • References

  • 22383849,31000719