SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


Na+ [SW|ABC transporter] (export) (ATP-binding protein)
42.63 kDa
protein length
386 aa Sequence Blast
gene length
1161 bp Sequence Blast
sodium export
Na+ [SW|ABC transporter] (export) (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Export of ions]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Sodium uptake/ export]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    297,170 298,330

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|D3F6337B94A633730E514B05CA852BE9AA3741B3|NatR]: activation, [Pubmed|17322186], in [regulon|D3F6337B94A633730E514B05CA852BE9AA3741B3|NatR regulon]
  • view in new tab

    Biological materials


  • BKE02760 ([gene|A8ADA02BBB549866DE330040CF6D06ECC3B00099|natB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTTTATAAATATGGCTCA, downstream forward: _UP4_TAAACTTGCGAAAGGAGAAA
  • BKK02760 ([gene|A8ADA02BBB549866DE330040CF6D06ECC3B00099|natB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTTTATAAATATGGCTCA, downstream forward: _UP4_TAAACTTGCGAAAGGAGAAA
  • References

  • 9106203,10092453,17322186