SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


assimilatory nitrite reductase (subunit)
11.76 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
utilization of nitrite as nitrogen source
assimilatory nitrite reductase (subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW|Anaerobic respiration]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of nitrate/ nitrite]
  • Gene

    355,412 355,732

    The protein

    Catalyzed reaction/ biological activity

  • 2 H2O + 3 NADP+ + NH4+ --> 5 H+ + 3 NADPH + nitrite (according to UniProt)
  • 2 H2O + 3 NAD+ + NH4+ --> 5 H+ + 3 NADH + nitrite (according to UniProt)
  • [SW|Domains]

  • Rieske domain (aa 8-104) (according to UniProt)
  • [SW|Cofactors]

  • NAD [Pubmed|11289299]
  • FeS cluster [pubmed|29292548]
  • Structure

  • [PDB|5BOK] (from Diaphorobacter sp., 30% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7836289], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|8799114,9765565], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab



  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials


  • BKE03290 ([gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCATTCCTCCTCAAT, downstream forward: _UP4_TGATCAAAAGACCGGATCAC
  • BKK03290 ([gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCATTCCTCCTCAAT, downstream forward: _UP4_TGATCAAAAGACCGGATCAC
  • References


  • 22103536,11289299
  • Original publications

  • 12823818,7868621,8799114,9765565,10972836,16885456,21091510,24214949,25755103