SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


assimilatory nitrite reductase (subunit)
11.76 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
utilization of nitrite as nitrogen source
assimilatory nitrite reductase (subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW|Anaerobic respiration]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of nitrate/ nitrite]
  • Gene

    355,412 355,732

    The protein

    Catalyzed reaction/ biological activity

  • 2 H2O + 3 NADP+ + NH4+ --> 5 H+ + 3 NADPH + nitrite (according to UniProt)
  • 2 H2O + 3 NAD+ + NH4+ --> 5 H+ + 3 NADH + nitrite (according to UniProt)
  • [SW|Domains]

  • Rieske domain (aa 8-104) (according to UniProt)
  • [SW|Cofactors]

  • NAD [Pubmed|11289299]
  • FeS cluster [pubmed|29292548]
  • Structure

  • [PDB|5BOK] (from Diaphorobacter sp., 30% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7836289], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [PubMed|8799114,9765565], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab



  • ''[protein|search|nasD]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials


  • BKE03290 ([gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCATTCCTCCTCAAT, downstream forward: _UP4_TGATCAAAAGACCGGATCAC
  • BKK03290 ([gene|A8998F46F68155A5C8AE2A2FBB95CA5A1635BB2B|nasE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCATTCCTCCTCAAT, downstream forward: _UP4_TGATCAAAAGACCGGATCAC
  • References


  • 22103536,11289299
  • Original publications

  • 12823818,7868621,8799114,9765565,10972836,16885456,21091510,24214949,25755103