SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


phosphofructokinase, glycolytic enzyme
34.10 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
catabolic enzyme in glycolysis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Glycolysis]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,986,588 2,987,547

    Phenotypes of a mutant

  • essential according to [Pubmed|12682299], non-essential according to [Pubmed|23420519,20473954]
  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + β-D-fructose 6-phosphate --> ADP + β-D-fructose 1,6-bisphosphate + H+ (according to UniProt)
  • Protein family

  • phosphofructokinase type A (PFKA) family (single member, according to UniProt)
  • Kinetic information

  • Allosteric Regulation (Reversible) [Pubmed|4269800]
  • [SW|Domains]

  • 3 x nucleotide binding domain (ATP) (2125), (154158), (171187)
  • Modification

  • phosphorylated on Arg-233 [Pubmed|22517742]
  • [SW|Cofactors]

  • Mg2+
  • Effectors of protein activity

  • Inhibited by citrate, PEP (Hill Coefficient 3) and Ca2+ (competes with Mg2+) in ''B. licheniformes'' [Pubmed|4269800].
  • Inhibited by ATP (competitively) and f6p (non-competitively) in ''G. stearothermophillus'' [Pubmed|8136379]
  • Activated by GDP and ADP in lower concentrations (1mM); above that inhibition, competing with the ATP for the binding site (in ''G. stearothermophillus'') [Pubmed|7873536]
  • Activated by NH4+ [Pubmed|7873536]
  • Structure

  • [PDB|4A3S] [Pubmed|22198292]
  • [PDB|1MTO] (mutant, complex with fructose-6-phosphate, ''Geobacillus stearothermophilus'')
  • [PDB|4PFK] (''Geobacillus stearothermophilus'')
  • [SW|Localization]

  • cytoplasm (homogeneous) [Pubmed|29439991,16479537,27708634]
  • Additional information

  • PfkA is a [SW|moonlighting protein]. [Pubmed|19193632]
  • extensive information on the structure and enzymatic properties of PfkA can be found at [ Proteopedia]
  • Expression and Regulation




  • twofold induced by glucose [Pubmed|11489127]
  • view in new tab

    Biological materials


  • GP590 ([gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • GP595 ([gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • GP1744: BSB1 [gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::''aphA3'', available in [SW|Jörg Stülke]' lab
  • GP1747: [gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::''aphA3'', available in [SW|Jörg Stülke]' lab, [Pubmed|27708634]
  • BKE29190 ([gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCATTCACCTCAGC, downstream forward: _UP4_TAATGTACAGCTGAAGGCTG
  • BKK29190 ([gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCATTCACCTCAGC, downstream forward: _UP4_TAATGTACAGCTGAAGGCTG
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP87, available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1266, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP393, available in [SW|Jörg Stülke]'s lab
  • for expression in ''B. subtilis'', in [SW|pBQ200]: pGP1422, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP511 (in [protein|search|pAC6]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1720 (in [SW|pBP43]), expression of '' pfkA-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab [Pubmed|27708634]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • FLAG-tag construct

  • GP1019 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References

  • 29439991,16479537,19193632,11489127,8136379,7873536,4269800,20473954,20572937,21803996,22198292,22198292,22517742,23420519,27708634,28189581