SubtiBank SubtiBank
ylzJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylzJ

germination protein, required for TepA activity
locus
BSU_16799
pI
4.91
mw
8.00 kDa
protein length
gene length
213 bp Sequence Blast
function
control of TepA activity
product
germination protein
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.3|Proteolysis during sporulation/ germination]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    1,751,935 1,752,147

    The protein

    Catalyzed reaction/ biological activity

  • the protein is required to allow [protein|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|TepA] proteolytic activity otwards SASPs [Pubmed|23927687]
  • Expression and Regulation

    Operons

    genes
    [gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]-[gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|23123912], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|23123912], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during [SW|sporulation] in the forespore ([protein|search|SigG], [SW|SpoVT]) [Pubmed|23123912]
  • view in new tab

    Biological materials

    Mutant

  • BKE16799 ([gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16799 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAGGCATCACGGTATAAA, downstream forward: _UP4_TAAGAATCCAACCCTTTTTT
  • BKK16799 ([gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16799 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAGGCATCACGGTATAAA, downstream forward: _UP4_TAAGAATCCAACCCTTTTTT
  • References

  • 22383849,23927687