SubtiBank SubtiBank
ylzJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylzJ

germination protein, required for TepA activity
locus
BSU16799
pI
4.91
mw
8.00 kDa
protein length
gene length
213 bp Sequence Blast
function
control of TepA activity
product
germination protein
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.3|Proteolysis during sporulation/ germination]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    1,751,935 1,752,147

    The protein

    Catalyzed reaction/ biological activity

  • the protein is required to allow [protein|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|TepA] proteolytic activity otwards SASPs [Pubmed|23927687]
  • Expression and Regulation

    Operons

    genes
    [gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]-[gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|23123912], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|23123912], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during [SW|sporulation] in the forespore ([protein|search|SigG], [SW|SpoVT]) [Pubmed|23123912]
  • view in new tab

    Biological materials

    Mutant

  • BKE16799 ([gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16799 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAGGCATCACGGTATAAA, downstream forward: _UP4_TAAGAATCCAACCCTTTTTT
  • BKK16799 ([gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16799 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAGGCATCACGGTATAAA, downstream forward: _UP4_TAAGAATCCAACCCTTTTTT
  • References

  • 22383849,23927687