SubtiBank SubtiBank
yetN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yetN

unknown
locus
BSU_07240
pI
4.74
mw
41.29 kDa
protein length
356 aa Sequence Blast
gene length
1071 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    791,462 792,532

    Expression and Regulation

    Operons

    genes
    [gene|A75A650861ACEF694E29475798DE31B88D98D794|yetN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B465 (yetN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1464 NBRP B. subtilis, Japan]
  • BKE07240 ([gene|A75A650861ACEF694E29475798DE31B88D98D794|yetN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAAACTCACCTTAT, downstream forward: _UP4_TAAAAAGTCCAGAAATCACT
  • BKK07240 ([gene|A75A650861ACEF694E29475798DE31B88D98D794|yetN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATAAACTCACCTTAT, downstream forward: _UP4_TAAAAAGTCCAGAAATCACT