SubtiBank SubtiBank
mta
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mta

transcriptional activator ([SW|MerR family]) of multidrug-efflux transporter genes, activates [gene|11997FE6BA6947E7C7E3DBE20B49C9FB758262B2|ymfD] expression
locus
BSU_36600
pI
4.95
mw
29.78 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast
function
regulation of multidrug-efflux transporter genes
product
transcriptional activator ([SW|MerR family])
essential
no
synonyms
ywnD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    Coordinates
    3,764,133 3,764,906

    The protein

    Protein family

  • [SW|MerR family]
  • [SW|Domains]

  • [SW|HTH merR-type domain] (aa 2-71) (according to UniProt)
  • Structure

  • [PDB|1JBG] (N-terminal domain), [PDB|1R8D] (complex of N-terminal domain with DNA)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A7326377132C670B60695EFE0A652B1E4F623698|mta]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10200972], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|10200972], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • regulation

  • positive autoregulation [Pubmed|10200972]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A197 (ywnD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/197 NBRP B. subtilis, Japan]
  • BKE36600 ([gene|A7326377132C670B60695EFE0A652B1E4F623698|mta]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATAACACCTCCTCTT, downstream forward: _UP4_TAAAGGCCGGGGGTTTACGC
  • BKK36600 ([gene|A7326377132C670B60695EFE0A652B1E4F623698|mta]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATAACACCTCCTCTT, downstream forward: _UP4_TAAAGGCCGGGGGTTTACGC
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
  • References

  • 18502870,14985361,11581256,11053850,10200972,9353933