SubtiBank SubtiBank
liaG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

liaG

maybe involved in resistance to bacitracin
locus
BSU33110
pI
5.83
mw
24.95 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yvqG

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,396,873 3,397,745

    Expression and Regulation

    Operons

    genes
    [gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
    description
    [Pubmed|16816187]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15273097], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    genes
    [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
    description
    [Pubmed|14651641]

    regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B038 (yvqG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1037 NBRP B. subtilis, Japan]
  • BKE33110 ([gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGTTTCATCCTTCTC, downstream forward: _UP4_TAGCACTAGGCAGAAGAAAG
  • BKK33110 ([gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGTTTCATCCTTCTC, downstream forward: _UP4_TAGCACTAGGCAGAAGAAAG
  • References

  • 19164152,15273097,16816187,15101989,17660417,16816187,20817675,22092710