SubtiBank SubtiBank
liaG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

liaG

maybe involved in resistance to bacitracin
locus
BSU_33110
pI
5.83
mw
24.95 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yvqG

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,396,873 3,397,745

    Expression and Regulation

    Operons

    genes
    [gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
    description
    [Pubmed|16816187]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15273097], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    genes
    [gene|B6D1159454969D1D578E05D5CE2259E079688510|liaI]-[gene|AE4BF12C368468C553EED7A696D5EFC63F56CA39|liaH]-[gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]-[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]-[gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]-[gene|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
    description
    [Pubmed|14651641]

    regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B038 (yvqG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1037 NBRP B. subtilis, Japan]
  • BKE33110 ([gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGTTTCATCCTTCTC, downstream forward: _UP4_TAGCACTAGGCAGAAGAAAG
  • BKK33110 ([gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGTTTCATCCTTCTC, downstream forward: _UP4_TAGCACTAGGCAGAAGAAAG
  • References

  • 19164152,15273097,16816187,15101989,17660417,16816187,20817675,22092710