SubtiBank SubtiBank


maybe involved in resistance to bacitracin
24.95 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    3,396,873 3,397,745

    Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15273097], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab



  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    Biological materials


  • MGNA-B038 (yvqG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33110 ([gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGTTTCATCCTTCTC, downstream forward: _UP4_TAGCACTAGGCAGAAGAAAG
  • BKK33110 ([gene|A71B0392FFF70EFFC096E7E9BD5FE30792821CDD|liaG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGTTTCATCCTTCTC, downstream forward: _UP4_TAGCACTAGGCAGAAGAAAG
  • References

  • 19164152,15273097,16816187,15101989,17660417,16816187,20817675,22092710