SubtiBank SubtiBank
mraZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mraZ

Putative DNA-binding protein
locus
BSU_15130
pI
4.97
mw
16.43 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yllB

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,580,121 1,580,552

    The protein

    Protein family

  • mraZ family (single member, according to UniProt)
  • [SW|Domains]

  • 2 [SW|SpoVT-AbrB domain]s (aa 7-47, aa 76-119) (according to UniProt)
  • Structure

  • [PDB|1N0G] (the homolog from ''Mycoplasma pneumoniae'') [Pubmed|15146477]
  • [SW|Localization]

  • nucleoid (heterogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|A7131ACFA0CF5C222237C76E502D4AAD1F9BA3E4|mraZ]-[gene|1F894D6895CE13AA006CFE13A702E46C568F6E79|mraW]-[gene|79712F4CF884A660C71B45B3397AEFA5C0AFA683|ftsL]-[gene|EBEFF9E0A524DCDA19382E5401B923B805E4C559|pbpB]
    description
    [Pubmed|8636036,8244929]

    regulation

  • constitutively expressed [Pubmed|15758244]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B129 (yllB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1128 NBRP B. subtilis, Japan]
  • 1A817 ( ''mraZ''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A817&Search=1A817 BGSC]
  • BKE15130 ([gene|A7131ACFA0CF5C222237C76E502D4AAD1F9BA3E4|mraZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTCTTGCCCCACTT, downstream forward: _UP4_TAATGATTCTTCGTGTATAA
  • BKK15130 ([gene|A7131ACFA0CF5C222237C76E502D4AAD1F9BA3E4|mraZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTCTTGCCCCACTT, downstream forward: _UP4_TAATGATTCTTCGTGTATAA
  • References

  • 8636036,16479537,8244929,16511046,15146477