SubtiBank SubtiBank
ykoM
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykoM

similar to transcriptional regulator ([SW|MarR family])
locus
BSU_13340
pI
9.47
mw
17.72 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    1,398,496 1,398,960

    The protein

    Paralogous protein(s)

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 14-146) (according to UniProt)
  • Structure

  • [PDB|3ZPL] (from Steptomyces coelicolor, corresponds to aa 17 ... 142, 24.6% identity) [pubmed|23748564]
  • Expression and Regulation

    Operons

    genes
    [gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE13340 ([gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTACCTCGTATATAG, downstream forward: _UP4_TTTCGTTAACTATTCTACAC
  • BKK13340 ([gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTACCTCGTATATAG, downstream forward: _UP4_TTTCGTTAACTATTCTACAC
  • GP2873 (''[gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]''::''zeo''), available in [SW|Jörg Stülke]'s lab
  • References

    Research papers

  • 23748564