SubtiBank SubtiBank


similar to transcriptional regulator ([SW|MarR family])
17.72 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    1,398,496 1,398,960

    The protein

    Paralogous protein(s)

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 14-146) (according to UniProt)
  • Structure

  • [PDB|3ZPL] (from Steptomyces coelicolor, corresponds to aa 17 ... 142, 24.6% identity) [pubmed|23748564]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE13340 ([gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTACCTCGTATATAG, downstream forward: _UP4_TTTCGTTAACTATTCTACAC
  • BKK13340 ([gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTACCTCGTATATAG, downstream forward: _UP4_TTTCGTTAACTATTCTACAC
  • GP2873 (''[gene|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]''::''zeo''), available in [SW|Jörg Stülke]'s lab
  • References

    Research papers

  • 23748564