SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


putative phosphomannomutase, internal part of YdzW
0.00 kDa
protein length
138 aa Sequence Blast
gene length
417 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    658,189 658,605

    Biological materials


  • BKE06076 ([gene|A6AA6EDE2C8A4C000B54E83B76614D29F3664751|ydzW/3]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCTGTTGCAATTAAATATC, downstream forward: _UP4_TGTGCTTACTATAAGAAAAA
  • BKK06076 ([gene|A6AA6EDE2C8A4C000B54E83B76614D29F3664751|ydzW/3]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCTGTTGCAATTAAATATC, downstream forward: _UP4_TGTGCTTACTATAAGAAAAA