SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


cystine [SW|ABC transporter] (binding protein)
30.02 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
cystine uptake
cystine [SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,007,426 3,008,235

    The protein

    Protein family

  • [SW|bacterial solute-binding protein 3 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|TcyK]
  • Structure

  • [PDB|4GVO] (from Listeria monocytogenes, 57% identity)
  • [SW|Localization]

  • attached to the membrane via [protein|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|TcyL]-[protein|B1DD32A3B3D1C0C5391A40834940257357A2F30F|TcyM] [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials


  • MGNA-A170 (ytmJ::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A948 ( ''tcyJ''::''kan''), [Pubmed|15262924], available at [ BGSC]
  • BKE29380 ([gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGCTTATTCATAGGCTGCC, downstream forward: _UP4_TTTGAAAAATAAATGGGGCG
  • BKK29380 ([gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACGCTTATTCATAGGCTGCC, downstream forward: _UP4_TTTGAAAAATAAATGGGGCG
  • References

  • 15262924,10092453,16109943,12193636,15668000,15272571,23944997