SubtiBank SubtiBank
yflA [2020-04-13 16:54:08]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yflA [2020-04-13 16:54:08]

general stress protein, similar to amino acid carrier protein, required for protection against paraquat stress
50.48 kDa
protein length
471 aa Sequence Blast
gene length
1416 bp Sequence Blast
protection against paraquat stress

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Alanine or glycine cation symporter family]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    844,770 846,185

    The protein

    Protein family

  • [SW|Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|AlsT], [protein|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|GlnT], [protein|A10EA56A7EDA2DF712B5BB87D94A818E39940B44|YrbD]
  • Structure

  • [PDB|6CSE] (sodium/alanine symporter from Methanococcus maripaludis S2, 37% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab


    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-C257 (yflA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07750 ([gene|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|yflA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATCACCCTTTTTTC, downstream forward: _UP4_TCCTAGTGTTTTGCTTTTGC
  • BKK07750 ([gene|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|yflA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATCACCCTTTTTTC, downstream forward: _UP4_TCCTAGTGTTTTGCTTTTGC
  • References

  • 15805528,20817675,22582280