SubtiBank SubtiBank
yflA [2018-10-16 14:40:19]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yflA [2018-10-16 14:40:19]

general stress protein, similar to amino acid carrier protein, required for protection against paraquat stress
locus
BSU07750
pI
9.86
mw
50.48 kDa
protein length
471 aa Sequence Blast
gene length
1413 bp Sequence Blast
function
protection against paraquat stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.3|Alanine or glycine cation symporter family]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    844,770 → 846,185

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|yflA]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    genes
    [gene|EA62F1DF6BB9204BB7A6B0CC6A05F63D711A451F|yflD]-[gene|530844B354D43308CC8CB7DC30DB9731A5D698EB|yflB]-[gene|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|yflA]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C257 (yflA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2255 NBRP B. subtilis, Japan]
  • BKE07750 (Δ[gene|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|yflA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATCACCCTTTTTTC, downstream forward: _UP4_TCCTAGTGTTTTGCTTTTGC
  • BKK07750 (Δ[gene|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|yflA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCATCACCCTTTTTTC, downstream forward: _UP4_TCCTAGTGTTTTGCTTTTGC
  • References

  • 15805528,20817675,22582280