SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


gamma-polyglutamate transporter,capsular polyglutamate biosynthesis, involved in controlling the D/L enantiomer ratio in polyglutamate
42.60 kDa
protein length
380 aa Sequence Blast
gene length
1143 bp Sequence Blast
capsular polyglutamate biosynthesis
gamma-polyglutamate transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • Gene

    3,697,821 3,698,963

    The protein

    Protein family

  • CapA family (with [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA] and [protein|F6C4634BF871D9A01E27014FFED7527C54BF560D|EpsA], according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19420703], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|19734658], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • additional information

  • expression of the operon is increased in '[protein|search|motA]' or '[protein|search|motB]' mutants due to increased [protein|search|DegU] phosphorylation [PubMed|24296669]
  • view in new tab

    Biological materials


  • MGNA-B121 (pgsA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35880 ([gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATCGTTTGACACACCT, downstream forward: _UP4_TCTAAATAATCGGAGTGATA
  • BKK35880 ([gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATCGTTTGACACACCT, downstream forward: _UP4_TCTAAATAATCGGAGTGATA
  • References


  • 20735481,16689787,29215550
  • Original publications

  • 11751809,19420703,16233197,20564357,20564574,24296669,21965392,27073802,29971620,30295732,31837088,16278834