SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cysteine desulfurase, required for NAD biosynthesis
43.63 kDa
protein length
395 aa Sequence Blast
gene length
1188 bp Sequence Blast
NAD biosynthesis
cysteine desulfurase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of NAD(P)]
  • Gene

    2,849,569 2,850,756

    The protein

    Catalyzed reaction/ biological activity

  • [sulfur carrier]-H + L-cysteine --> [sulfur carrier]-SH + L-alanine (according to UniProt)
  • Protein family

  • [SW|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|YrvO], [protein|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|YcbU], [protein|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|NifZ], [protein|88ACE6B79534338F7C72F107B35A0B2384007088|SufS]
  • [SW|Cofactors]

  • pyridoxalphosphate [Pubmed|25447671]
  • Structure

  • [PDB|4R5F] (from Archaeoglobus fulgidus, 34% identity) [pubmed|25447670]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8444804], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|8444804,16199587], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|8444804,16199587]
  • view in new tab

    Biological materials


  • BKE27880 ([gene|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|nifS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGGTCTTCCTCCATCC, downstream forward: _UP4_ATATTGACCGAAGAATTAAA
  • BKK27880 ([gene|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|nifS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGGTCTTCCTCCATCC, downstream forward: _UP4_ATATTGACCGAAGAATTAAA
  • References


  • 25447671
  • Original publications

  • 8444804,16199587,16199587,14567704,25447670