SubtiBank SubtiBank
nifS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nifS

cysteine desulfurase, required for NAD biosynthesis
locus
BSU_27880
pI
6.43
mw
43.63 kDa
protein length
395 aa Sequence Blast
gene length
1188 bp Sequence Blast
function
NAD biosynthesis
product
cysteine desulfurase
essential
no
ec
2.8.1.7
synonyms
iscS

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.11|Biosynthesis of NAD(P)]
  • Gene

    Coordinates
    2,849,569 2,850,756

    The protein

    Catalyzed reaction/ biological activity

  • [sulfur carrier]-H + L-cysteine --> [sulfur carrier]-SH + L-alanine (according to UniProt)
  • Protein family

  • [SW|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|YrvO], [protein|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|YcbU], [protein|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|NifZ], [protein|88ACE6B79534338F7C72F107B35A0B2384007088|SufS]
  • [SW|Cofactors]

  • pyridoxalphosphate [Pubmed|25447671]
  • Structure

  • [PDB|4R5F] (from Archaeoglobus fulgidus, 34% identity) [pubmed|25447670]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|nifS]-[gene|510DE075EA964D22C42DEB171509F6CDA600A402|nadR]
    description
    [Pubmed|8444804]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8444804], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|8444804,16199587], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|8444804,16199587]
  • view in new tab

    Biological materials

    Mutant

  • BKE27880 ([gene|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|nifS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGGTCTTCCTCCATCC, downstream forward: _UP4_ATATTGACCGAAGAATTAAA
  • BKK27880 ([gene|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|nifS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGGTCTTCCTCCATCC, downstream forward: _UP4_ATATTGACCGAAGAATTAAA
  • References

    Reviews

  • 25447671
  • Original publications

  • 8444804,16199587,16199587,14567704,25447670