SubtiBank SubtiBank
ytoQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytoQ

unknown
locus
BSU_29850
pI
5.77
mw
16.65 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,054,746 3,055,192

    Expression and Regulation

    Operons

    genes
    [gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B532 (ytoQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1531 NBRP B. subtilis, Japan]
  • BKE29850 ([gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAAAAATCCCTCCTT, downstream forward: _UP4_TAAGAAAAAAGCTTGTCGAT
  • BKK29850 ([gene|A66C34183025AFAD7D935C7B7E107BEE94F9B362|ytoQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAAAAATCCCTCCTT, downstream forward: _UP4_TAAGAAAAAAGCTTGTCGAT
  • Expression vectors

  • IPTG inducible expression of Strep-ytoQ in E. coli: pBP641 (in [SW|pGP172]) and pBP642 (in [SW|pGP574]), available in [SW|Fabian Commichau]'s lab
  • Constitutive expression of ytoQ in B. subtilis: pBP639 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab, [Pubmed|29027347]
  • lacZ fusion

  • pBP638 (in [SW|pAC7]), available in [SW|Fabian Commichau]'s lab [Pubmed|29027347]
  • labs

  • [SW|Fabian Commichau], Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
  • References

    Research papers

  • 11918677,29027347