SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


uridine kinase
24.34 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
UMP synthesis
uridine kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    2,792,218 2,792,853

    The protein

    Catalyzed reaction/ biological activity

  • ATP + uridine --> ADP + H+ + UMP (according to UniProt)
  • ATP + cytidine --> ADP + CMP + H+ (according to UniProt)
  • Protein family

  • uridine kinase family (single member, according to UniProt)
  • Structure

  • [PDB|3W8R] (from Thermus thermophilus, 55% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE27330 ([gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTGGATTCTTACCCATGG, downstream forward: _UP4_TAATACCATAGCATAGACAT
  • BKK27330 ([gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTGGATTCTTACCCATGG, downstream forward: _UP4_TAATACCATAGCATAGACAT