SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


uridine kinase
24.34 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
UMP synthesis
uridine kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    2,792,218 2,792,853

    The protein

    Catalyzed reaction/ biological activity

  • ATP + uridine = ADP + UMP (according to Swiss-Prot)
  • Protein family

  • uridine kinase family (according to Swiss-Prot)
  • Structure

  • [PDB|3W8R] (from Thermus thermophilus, 55% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE27330 ([gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTGGATTCTTACCCATGG, downstream forward: _UP4_TAATACCATAGCATAGACAT
  • BKK27330 ([gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACTGGATTCTTACCCATGG, downstream forward: _UP4_TAATACCATAGCATAGACAT