SubtiBank SubtiBank
kinC
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

kinC

two-component sensor kinase, phosphorylates Spo0F and Spo0A, part of the phosphorelay, governs expression of genes involved in biofilm formation
locus
BSU14490
pI
6.22
mw
48.68 kDa
protein length
428 aa Sequence Blast
gene length
1284 bp Sequence Blast
function
initiation of sporulation
product
two-component sensor kinase
essential
no
synonyms
ssb

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.1|The kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.1|The kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    1,518,333 → 1,519,619

    Phenotypes of a mutant

  • defective in [SW|biofilm formation] [Pubmed|22882210]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F] as part of the [SW|phosphorelay], but also direct phosphorylation of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] [Pubmed|19114652]
  • mainly active in the younger, outer regions of a colony (with [protein|511E71BB1981758857854C8E9BF657287CE60C11|KinD]) [Pubmed|21097618]
  • phosphorylates [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] in response to the presence of surfactin [Pubmed|22882210], this has been refuted [Pubmed|25701730]
  • required for initiation of [SW|sliding] together with [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB] [Pubmed|26152584]
  • [SW|Domains]

  • two transmembrane segments
  • [SW|PAS domain]
  • C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • activity is triggered by potassium leakage [Pubmed|19114652], this has been refuted [Pubmed|25701730]
  • activity is triggered by polyisoprenoid lipids formed by [protein|E5F32D960F6FF50A7B0E4B268D2296FE1A291512|YisP] [Pubmed|20713508]
  • activity is stimulated by the interaction with [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT] [Pubmed|26297017]
  • [SW|Localization]

  • cell membrane (Heterogeneous) [Pubmed|16479537]
  • co-localizes with [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT] in discrete foci in the membrane [Pubmed|20713508]
  • the localization of [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC] in membrane microdomains depends on [protein|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|FloA] and [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT] [Pubmed|22882210], this has been refuted [Pubmed|25701730]
  • Expression and Regulation

    Operons

    genes
    [gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]-[gene|22DBF4D1F93519A95E6BCC0FB1AC2387DF444E27|ykqA]-[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002614], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|8002615], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • constitutively expressed [Pubmed|12562800]
  • view in new tab

    Biological materials

    Mutant

  • 1A632 ( ''kinC''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A632&Search=1A632 BGSC]
  • BAL393 (''kinC''::''spc'')[Pubmed|26152584]
  • BKE14490 (Δ[gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGACCACCTGCCGCTT, downstream forward: _UP4_GACAGCTGAGAGGAGAAAAA
  • BKK14490 (Δ[gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGACCACCTGCCGCTT, downstream forward: _UP4_GACAGCTGAGAGGAGAAAAA
  • References

    Reviews

  • 25934647,25652542
  • Original publications

  • 26152584,19114652,10094672,11069677,16166384,20713508,8002615,16479537,8002614,20946851,20971918,21097618,22882210,23927765,25701730,26297017,26152584,28461449