SubtiBank SubtiBank
cydC [2018-05-04 18:19:30]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cydC [2018-05-04 18:19:30]

ABC transporter required for expression of cytochrome bd (ATP-binding protein)
locus
BSU38740
pI
8.51
mw
62.63 kDa
protein length
567 aa Sequence Blast
gene length
1701 bp Sequence Blast
function
required for expression of cytochrome bd
product
ABC transporter (ATP-binding protein)
essential
no
synonyms
yxkM

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.3|Regulatory ABC transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.1|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,975,088 → 3,976,791

    The protein

    [SW|Domains]

  • has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|C0459C0D45E31561D281E016D86CD80DCAF13357|cydA]-[gene|E66EAB3C172ED8D1D26C675A7338B8153FB66987|cydB]-[gene|A65576E0261F1950A0DAD72B2432D97AB3EB2AA5|cydC]-[gene|244BF9E397FDB0691FFAA8C9D419B0AE417CACE1|cydD]
    description
    [Pubmed|16207915]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [PubMed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|15231791], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|17322317], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|17322317]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B747 (cydC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1746 NBRP B. subtilis, Japan]
  • BKE38740 (Δ[gene|A65576E0261F1950A0DAD72B2432D97AB3EB2AA5|cydC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATATCGAAACAGGTCTTTTC, downstream forward: _UP4_AAGGCACAACTGGGGGAAAG
  • BKK38740 (Δ[gene|A65576E0261F1950A0DAD72B2432D97AB3EB2AA5|cydC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATATCGAAACAGGTCTTTTC, downstream forward: _UP4_AAGGCACAACTGGGGGAAAG
  • References

  • 16207915,17322317,10092453,15231791,9852001,24958725,15231791,17322317