SubtiBank SubtiBank
cydC [2018-05-04 18:51:19]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cydC [2018-05-04 18:51:19]

[SW|ABC transporter] required for expression of cytochrome bd (ATP-binding protein)
locus
BSU38740
pI
8.51
mw
62.63 kDa
protein length
567 aa Sequence Blast
gene length
1701 bp Sequence Blast
function
required for expression of cytochrome bd
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms
yxkM

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.3|Regulatory ABC transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.1|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,975,088 → 3,976,791

    The protein

    [SW|Domains]

  • has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
  • Structure

  • [PDB|2HYD] (from Staphylococcus aureus, 27% identity)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|C0459C0D45E31561D281E016D86CD80DCAF13357|cydA]-[gene|E66EAB3C172ED8D1D26C675A7338B8153FB66987|cydB]-[gene|A65576E0261F1950A0DAD72B2432D97AB3EB2AA5|cydC]-[gene|244BF9E397FDB0691FFAA8C9D419B0AE417CACE1|cydD]
    description
    [Pubmed|16207915]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [PubMed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|15231791], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|17322317], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|17322317]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B747 (cydC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1746 NBRP B. subtilis, Japan]
  • BKE38740 (Δ[gene|A65576E0261F1950A0DAD72B2432D97AB3EB2AA5|cydC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATATCGAAACAGGTCTTTTC, downstream forward: _UP4_AAGGCACAACTGGGGGAAAG
  • BKK38740 (Δ[gene|A65576E0261F1950A0DAD72B2432D97AB3EB2AA5|cydC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATATCGAAACAGGTCTTTTC, downstream forward: _UP4_AAGGCACAACTGGGGGAAAG
  • References

  • 16207915,17322317,10092453,15231791,9852001,24958725,15231791,17322317