SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|ABC transporter] required for expression of cytochrome bd (ATP-binding protein)
62.63 kDa
protein length
567 aa Sequence Blast
gene length
1704 bp Sequence Blast
required for expression of cytochrome bd
[SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Regulatory ABC transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,975,088 3,976,791

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
  • [SW|ABC transmembrane type-1 domain] (aa 15-298) (according to UniProt)
  • [SW|ABC transporter domain] (aa 321-561) (according to UniProt)
  • Structure

  • [PDB|2HYD] (from Staphylococcus aureus, 27% identity) [pubmed|16943773]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [PubMed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|15231791], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|17322317], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|17322317]
  • view in new tab

    Biological materials


  • MGNA-B747 (cydC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38740 ([gene|A65576E0261F1950A0DAD72B2432D97AB3EB2AA5|cydC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATATCGAAACAGGTCTTTTC, downstream forward: _UP4_AAGGCACAACTGGGGGAAAG
  • BKK38740 ([gene|A65576E0261F1950A0DAD72B2432D97AB3EB2AA5|cydC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATATCGAAACAGGTCTTTTC, downstream forward: _UP4_AAGGCACAACTGGGGGAAAG
  • References

  • 16207915,17322317,10092453,15231791,9852001,24958725,15231791,17322317,16943773