SubtiBank SubtiBank
yxiS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxiS

general stress protein, survival of ethanol, paraquat and salt stresses
locus
BSU_39040
pI
4.89
mw
10.99 kDa
protein length
gene length
291 bp Sequence Blast
function
survival of stress conditions
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    4,007,803 4,008,093

    Expression and Regulation

    Operons

    genes
    [gene|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]-[gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|7559348,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B797 (yxiS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1796 NBRP B. subtilis, Japan]
  • BKE39040 ([gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCATGCTCCTTATG, downstream forward: _UP4_TAAAAAAAGAGACATCCTGT
  • BKK39040 ([gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCATGCTCCTTATG, downstream forward: _UP4_TAAAAAAAGAGACATCCTGT
  • References

  • 16672620,15805528,22582280