SubtiBank SubtiBank
yxiS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxiS

general stress protein, survival of ethanol, paraquat and salt stresses
locus
BSU39040
pI
4.89
mw
10.99 kDa
protein length
gene length
291 bp Sequence Blast
function
survival of stress conditions
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    4,007,803 4,008,093

    Expression and Regulation

    Operons

    genes
    [gene|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]-[gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|7559348,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B797 (yxiS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1796 NBRP B. subtilis, Japan]
  • BKE39040 ([gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCATGCTCCTTATG, downstream forward: _UP4_TAAAAAAAGAGACATCCTGT
  • BKK39040 ([gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTCATGCTCCTTATG, downstream forward: _UP4_TAAAAAAAGAGACATCCTGT
  • References

  • 16672620,15805528,22582280