SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, similar to oligo-1,6-glucosidase
65.64 kDa
protein length
561 aa Sequence Blast
gene length
1686 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    306,459 308,144

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of (16)-alpha-D-glucosidic linkages in some oligosaccharides produced from starch and glycogen by alpha-amylase, and in isomaltose (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|YugT], [protein|2EB9E0C492DF57DF683817E31D6DD34D7580E631|TreA], [protein|6E5AB4620F9A896C32CD77AF314C67035814AE0A|MalL]
  • Structure

  • [PDB|1UOK] (from ''Bacillus Cereus'', 54% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528,11544224]
  • view in new tab

    Biological materials


  • BKE02840 ([gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGCAATCCCCCTGTT, downstream forward: _UP4_TAATGATTGAAGTAGCCCGG
  • BKK02840 ([gene|A641BA91317CBCFE34A2BE69007247F209075095|ycdG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGCAATCCCCCTGTT, downstream forward: _UP4_TAATGATTGAAGTAGCCCGG
  • References

  • 11544224