SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


19.72 kDa
protein length
177 aa Sequence Blast
gene length
534 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,899,272 3,899,805

    The protein


  • cell membrane (according to UniProt)
  • Biological materials


  • MGNA-B235 (ywdE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37990 ([gene|A5E65408D61B9478ADB45A4C5CA2A878CBFCEAB5|ywdE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACATACACCTCCTTTA, downstream forward: _UP4_TAGTATGCCGTTTCAGTAGG
  • BKK37990 ([gene|A5E65408D61B9478ADB45A4C5CA2A878CBFCEAB5|ywdE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACATACACCTCCTTTA, downstream forward: _UP4_TAGTATGCCGTTTCAGTAGG