SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


70.40 kDa
protein length
642 aa Sequence Blast
gene length
1929 bp Sequence Blast
cell wall recycling

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Utilization of cell wall components]
  • Gene

    186,452 188,380

    Phenotypes of a mutant

  • increased autolysis [Pubmed|20400549]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves muropeptides derived from peptidoglycan, but not peptidoglycan itself [Pubmed|20400549]
  • Hydrolysis of terminal non-reducing N-acetyl-D-hexosamine residues in N-acetyl-beta-D-hexosaminides (according to UniProt)
  • Protein family

  • glycosyl hydrolase 3 family (single member, according to UniProt)
  • Structure

  • [PDB|3BMX] [Pubmed|20826810]
  • [SW|Localization]

  • secreted (with signal peptide), remains to some extent cell wall-associated [Pubmed|20400549]
  • Additional information

  • The gene is mis-annotated in KEGG as an ortholog of beta-N-acetylhexosaminidase EC It is marked in MetaCyc as similar to beta-hexosaminidase. No EC annotation is available in Swiss-ProtSwiss-Prot.supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation



    regulatory mechanism

  • [protein|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR]: repression, [pubmed|30038046], in [regulon|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR regulon]
  • regulation

  • expressed in late exponential and early stationary phase [Pubmed|20400549]
  • view in new tab

    Biological materials


  • available in [SW|Christoph Mayer]'s lab [Pubmed|20400549]
  • BKE01660 ([gene|A5D4BF262BD365DCEBA9358C8DB295E605DE4D84|nagZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAAACTTCCTCCTATC, downstream forward: _UP4_AGACCGCTTTAATAAGGAGG
  • BKK01660 ([gene|A5D4BF262BD365DCEBA9358C8DB295E605DE4D84|nagZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAAACTTCCTCCTATC, downstream forward: _UP4_AGACCGCTTTAATAAGGAGG
  • References

  • 10627040,20400549,4628806,4196675,22383849,26963691,30038046,30673842,30978418