SubtiBank SubtiBank
pyrP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pyrP

uracil permease
locus
BSU15480
pI
9.50
mw
45.41 kDa
protein length
435 aa Sequence Blast
gene length
1308 bp Sequence Blast
function
uracil transport in/out via proton symport
product
uracil permease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,619,023 1,620,330

    The protein

    Protein family

  • xanthine/uracil permease family (according to Swiss-Prot)
  • Structure

  • [PDB|3QE7] (E. coli uracil transporter, 43% identity) [pubmed|21423164]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15480 ([gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTTCCCCCTGAT, downstream forward: _UP4_ACATCTGAACAACATCATAT
  • BKK15480 ([gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTTCCCCCTGAT, downstream forward: _UP4_ACATCTGAACAACATCATAT
  • References

  • 7868607,8206849,12896995,16133632,1709162,17322189,18763711,21423164