SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


18.10 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,602,074 3,602,547

    The protein


  • [SW|HTH marR-type domain] (aa 6-157) (according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (7-fold) ([protein|search|CcpA]) [Pubmed|12850135], subject to carbon catabolite repression (7-fold: [protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • MGNA-A334 (yvnA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35050 ([gene|A58CB284AC04FBFD1EEF6D8DC1BB37E095E2B4FC|yvnA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTTGCCTCTCTGAT, downstream forward: _UP4_TAAAAAGAGTCTCACCCGCA
  • BKK35050 ([gene|A58CB284AC04FBFD1EEF6D8DC1BB37E095E2B4FC|yvnA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTTGCCTCTCTGAT, downstream forward: _UP4_TAAAAAGAGTCTCACCCGCA
  • References

  • 12850135,20817675