SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


ribosomal protein
6.67 kDa
protein length
gene length
189 bp Sequence Blast
ribosomal protein L28

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosomal proteins]
  • Gene

    1,655,599 1,655,787

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bL28 family (single member, according to UniProt)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Additional information

  • the protein is significantly underrepresented in 45S assembly intermediates that accumulate upon depletion of [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] [Pubmed|24335279,23700310]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [Pubmed|11948165], in [regulon|stringent response|stringent response]
  • view in new tab

    Biological materials


  • BKE15820 ([gene|A58851E0B5C4DE4D6F3C16FF8C009001E393C3B8|rpmB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTCCCTCCTCACT, downstream forward: _UP4_TAACAAAATGAACGCCTGCC
  • BKK15820 ([gene|A58851E0B5C4DE4D6F3C16FF8C009001E393C3B8|rpmB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTCCCTCCTCACT, downstream forward: _UP4_TAACAAAATGAACGCCTGCC
  • References

  • 19653700,23002217,23033921,23700310,24335279,25903689