SubtiBank SubtiBank
bcrC [2018-06-21 16:05:10]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

bcrC [2018-06-21 16:05:10]

undecaprenyl pyrophosphate phosphatase, produces the carrier lipid for cell wall synthesis, secondary bacitracin resistance determinant
21.58 kDa
protein length
193 aa Sequence Blast
gene length
579 bp Sequence Blast
cell wall synthesis, resistance to bacitracin and oxidative stress
undecaprenyl pyrophosphate phosphatase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of the carrier lipid undecaprenylphosphate]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of the carrier lipid undecaprenylphosphate]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,758,547 → 3,759,128

    Phenotypes of a mutant

  • 5-fold increased sensitivity to bacitracin [Pubmed|26815905]
  • reduced growth rate [Pubmed|26815905]
  • increased susceptibility to rare earth elements [Pubmed|22904278]
  • a ''[gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]'' ''[gene|5A7A79A11FCBA9C90DAF526B8EAB6791D7D88E99|uppP]'' double mutant is not viable (unless ''[gene|0BF97861B52722347C4BBE533E574CF548A8283E|pgpB]'' is artificially expressed) [Pubmed|27528508]
  • The protein

    Catalyzed reaction/ biological activity

  • undecaprenyl pyrophosphate -→ undecaprenyl phosphate
  • Protein family

  • bcrC/ybjG/ywoA family (according to Swiss-Prot)
  • Effectors of protein activity

  • inhibited by heptaprenyl pyrophosphate which accumulates in a ''[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]'' mutant [Pubmed|24806199]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Additional information

  • there is a second undecaprenyl pyrophosphate phosphatase in ''B. subtilis'', [protein|5A7A79A11FCBA9C90DAF526B8EAB6791D7D88E99|UppP]. However, [protein|5A7A79A11FCBA9C90DAF526B8EAB6791D7D88E99|UppP] seems to play only a minor role. [Pubmed|22904278]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [Pubmed|18156261], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|12399481], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • expression activated by glucose (3.3 fold) [Pubmed|12850135]
  • expression is induced by bacitracin [pubmed|32019833]
  • view in new tab

    Biological materials


  • MGNA-A214 (ywoA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36530 (Δ[gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAATCACCTTTTACAT, downstream forward: _UP4_TAAGAAAGACAAAAGCCGGC
  • BKK36530 (Δ[gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAATCACCTTTTACAT, downstream forward: _UP4_TAAGAAAGACAAAAGCCGGC
  • References


  • 27344142
  • Original publications

  • 17434969,18156261,22904278,14612242,12486040,12399481,17434969,15838020,14651641,24068241,24806199,21926231,15946938,26364265,27528508,27578312,26815905,29259598