SubtiBank SubtiBank
bcrC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bcrC

undecaprenyl pyrophosphate phosphatase, produces the carrier lipid for cell wall synthesis, secondary bacitracin resistance determinant
locus
BSU36530
pI
9.45
mw
21.58 kDa
protein length
193 aa Sequence Blast
gene length
582 bp Sequence Blast
function
cell wall synthesis, resistance to bacitracin and oxidative stress
product
undecaprenyl pyrophosphate phosphatase
essential
no
ec
3.6.1.27
synonyms
ywoA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.8|Biosynthesis of the carrier lipid undecaprenylphosphate]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.5|Biosynthesis of the carrier lipid undecaprenylphosphate]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,758,547 3,759,128

    Phenotypes of a mutant

  • 5-fold increased sensitivity to bacitracin [Pubmed|26815905]
  • reduced growth rate [Pubmed|26815905]
  • increased susceptibility to rare earth elements [Pubmed|22904278]
  • a ''[gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]'' ''[gene|5A7A79A11FCBA9C90DAF526B8EAB6791D7D88E99|uppP]'' double mutant is not viable (unless ''[gene|0BF97861B52722347C4BBE533E574CF548A8283E|yodM]'' is artificially expressed) [Pubmed|27528508]
  • The protein

    Catalyzed reaction/ biological activity

  • undecaprenyl pyrophosphate - undecaprenyl phosphate
  • Protein family

  • bcrC/ybjG/ywoA family (according to Swiss-Prot)
  • Effectors of protein activity

  • inhibited by heptaprenyl pyrophosphate which accumulates in a ''[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]'' mutant [Pubmed|24806199]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Additional information

  • there is a second undecaprenyl pyrophosphate phosphatase in ''B. subtilis'', [protein|5A7A79A11FCBA9C90DAF526B8EAB6791D7D88E99|UppP]. However, [protein|5A7A79A11FCBA9C90DAF526B8EAB6791D7D88E99|UppP] seems to play only a minor role. [Pubmed|22904278]
  • Expression and Regulation

    Operons

    genes
    [gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [Pubmed|18156261], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|12399481], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • expression activated by glucose (3.3 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A214 (ywoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/214 NBRP B. subtilis, Japan]
  • BKE36530 ([gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAATCACCTTTTACAT, downstream forward: _UP4_TAAGAAAGACAAAAGCCGGC
  • BKK36530 ([gene|A58729F80A0BB6683648E472E385711A6DE4D373|bcrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAATCACCTTTTACAT, downstream forward: _UP4_TAAGAAAGACAAAAGCCGGC
  • References

    Reviews

  • 27344142
  • Original publications

  • 17434969,18156261,22904278,14612242,12486040,12399481,17434969,15838020,14651641,24068241,24806199,21926231,15946938,26364265,27528508,27578312,26815905,29259598,29914988