SubtiBank SubtiBank
yloC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yloC

unknown
locus
BSU_15660
pI
4.87
mw
33.48 kDa
protein length
291 aa Sequence Blast
gene length
876 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,640,720 1,641,595

    The protein

    Protein family

  • UPF0701 family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]

    description

  • [pubmed|22383849]
  • sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|23396918], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during vegetative growth and early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|23396918]
  • view in new tab

    genes
    [gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]-[gene|2B67C63442F28F6BCBA3BA6DE4B563C73E8DF16C|yloI]-[gene|AF5ADDA2A98EC18BB72A81AA0336E639C0D1F430|priA]-[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA]-[gene|06971E9AAB033E2878914A76645F99E97CE8A90A|fmt]-[gene|1370D8783450D538C71E3DE8EA5B37DFEE073FF0|yloM]-[gene|5DEBD84E5937DB8B7F29C729FAA0076DF86A5451|yloN]

    description

  • [pubmed|22383849]
  • view in new tab

    genes
    [gene|7821A09DADC6EAF589A882F05CC34BE900E06F2A|yloB]-[gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]-[gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]-[gene|1BC994DE60A7BB35DEDD7154581A396D29AA94A7|gmk]-[gene|921933B6B893083F151AABDEDCBC65F2E55677BE|yloH]

    description

  • [pubmed|22383849]
  • regulation

  • expressed during sporulation in the mother cell [pubmed|12161109]
  • view in new tab

    Biological materials

    Mutant

  • GP2609 ([gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]::''cat''), available in [SW|Jörg Stülke]'s lab
  • MGNA-B131 (yloC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1130 NBRP B. subtilis, Japan]
  • BKE15660 ([gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAAACACCCAATTC, downstream forward: _UP4_TAGTGACTGTGCGTATTGTT
  • BKK15660 ([gene|A57D2C1536F3E93CD687C28C59FF297355CAB303|yloC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAAACACCCAATTC, downstream forward: _UP4_TAGTGACTGTGCGTATTGTT