SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


Spo0A-P phosphatase, control of the phosphorelay
9.65 kDa
protein length
gene length
258 bp Sequence Blast
initiation of sporulation
Spo0A-P phosphatase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Phosphatases controlling the phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Phosphatases controlling the phosphorelay]
  • Gene

    1,430,684 1,430,941

    The protein

    Protein family

  • spo0E family (with [protein|search|ynzd ]and [protein|022933D89666CDD2ACE39BCBB78D349BAF8E899B|YisI], according to UniProt)
  • Paralogous protein(s)

  • [protein|A2250786C40A23A5EBD830B3853DE5187B3D24EC|YnzD]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1901567], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|22210769], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|2504584], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, of the [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]-dependent promoter [Pubmed|22524514], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • induced under stress conditions ([protein|search|SigB]) [Pubmed|22210769]
  • additional information

  • Spo0E is degraded by [protein|search|FtsH]
  • view in new tab

    Biological materials


  • BKE13640 ([gene|A574974B6F4FF46DC69E03AE021651C67089866F|spo0E]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTTCACCCCTCGCC, downstream forward: _UP4_TAGCGGCCTATCAGATGCAT
  • BKK13640 ([gene|A574974B6F4FF46DC69E03AE021651C67089866F|spo0E]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACTTCACCCCTCGCC, downstream forward: _UP4_TAGCGGCCTATCAGATGCAT
  • labs

  • [SW|Tony Wilkinson], York University, U.K. [ homepage]
  • References


  • 19995980
  • Original publications

  • 2838724,1901567,8127878,11112444,11679073,12067336,15916600,15057450,17001075,18045868,19050850,19332814,22524514,22210769,2504584,22142536