SubtiBank SubtiBank
khtS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

khtS

modulator of [protein|9A54C82323BA9220CAA6041E3745FAB9E222FE78|KhtU] activity
locus
BSU_09870
pI
7.02
mw
12.64 kDa
protein length
112 aa Sequence Blast
gene length
339 bp Sequence Blast
function
control of potassium ion efflux
product
modulator of [protein|9A54C82323BA9220CAA6041E3745FAB9E222FE78|KhtU] activity
essential
no
synonyms
yhaS

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.3|Potassium uptake/ export]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,060,988 1,061,326

    The protein

    [SW|Localization]

  • cell membrane (peripheral, cytoplasmic side) [pubmed|14987767]
  • Expression and Regulation

    Operons

    genes
    [gene|A54E8E38AEF596D09B4BEB64D9F539A8AD34E73D|khtS]-[gene|D8A8FBC05B9665F72A88685D2B33822C2BB84C62|khtT]-[gene|9A54C82323BA9220CAA6041E3745FAB9E222FE78|khtU]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A681 ([gene|A54E8E38AEF596D09B4BEB64D9F539A8AD34E73D|khtS]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/681 NBRP B. subtilis, Japan]
  • GP2078 ([gene|A54E8E38AEF596D09B4BEB64D9F539A8AD34E73D|khtS]-[gene|D8A8FBC05B9665F72A88685D2B33822C2BB84C62|khtT]-[gene|9A54C82323BA9220CAA6041E3745FAB9E222FE78|khtU]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE09870 ([gene|A54E8E38AEF596D09B4BEB64D9F539A8AD34E73D|khtS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAGATATCCCTTCTTT, downstream forward: _UP4_TAATTTGCTCAAGTTTTATT
  • BKK09870 ([gene|A54E8E38AEF596D09B4BEB64D9F539A8AD34E73D|khtS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAGATATCCCTTCTTT, downstream forward: _UP4_TAATTTGCTCAAGTTTTATT
  • References

  • 14987767,24330391