SubtiBank SubtiBank
yngL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yngL

unknown
locus
BSU18290
pI
9.62
mw
14.53 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,959,695 1,960,087

    The protein

    [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A5238B160277C6440977DE099D3414E2A83ACD81|yngL]
    description
    [Pubmed|22383849]
    regulation
    expressed during [SW|sporulation] [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B085 (yngL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1084 NBRP B. subtilis, Japan]
  • BKE18290 ([gene|A5238B160277C6440977DE099D3414E2A83ACD81|yngL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAGAAGCCTCCAAGAA, downstream forward: _UP4_TAAAAGCGGTTCACAACATG
  • BKK18290 ([gene|A5238B160277C6440977DE099D3414E2A83ACD81|yngL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAGAAGCCTCCAAGAA, downstream forward: _UP4_TAAAAGCGGTTCACAACATG