SubtiBank SubtiBank
ntdB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ntdB

kanosamine-6-phosphate phosphatase
locus
BSU_10540
pI
5.35
mw
33.05 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
function
synthesis of the antibiotic kanosamine
product
kanosamine-6-phosphate phosphatase
essential
no
synonyms
yhjK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    1,127,466 1,128,314

    The protein

    Catalyzed reaction/ biological activity

  • kanosamine-6-phosphate --> kanosamine [Pubmed|23586652]
  • Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • [SW|Cof family] (according to UniProt)
  • Structure

  • [PDB|3GYG]
  • Expression and Regulation

    Operons

    genes
    [gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]-[gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]-[gene|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC]-[gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]
    description
    [Pubmed|17056753]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14612444], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|NtdR]: positive regulation, in [regulon|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|NtdR regulon]
  • regulation

  • induced by 3,3'-neotrehalosadiamine ([protein|search|NtdR]) [Pubmed|14612444]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A724 (yhjK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/724 NBRP B. subtilis, Japan]
  • BKE10540 ([gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGATGTTCAACCGTGGATA, downstream forward: _UP4_ATTGGATCATGAGGAGGAAA
  • BKK10540 ([gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGATGTTCAACCGTGGATA, downstream forward: _UP4_ATTGGATCATGAGGAGGAAA
  • References

    Reviews

  • 21512256
  • Original publications

  • 19087206,17056753,14612444,23586652