SubtiBank SubtiBank
ydcI [2018-12-03 17:05:59]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydcI [2018-12-03 17:05:59]

81.23 kDa
protein length
719 aa Sequence Blast
gene length
2157 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.5|RNase/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    525,743 → 527,902

    The protein


  • [SW|YqgF/RNase H-like domain] (aa 321 ... 446) (according to the Interpro database)
  • [SW|S1 domain] (aa 646 ... 718) (according to the Interpro database)
  • Modification

  • phosphorylated on Arg-473 [Pubmed|22517742]
  • Structure

  • [PDB|2OCE] (the protein from Pseudomonas aeruginosa, 43% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C101 (ydcI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04780 (Δ[gene|A4DB115D36907DE3EE6F80738E4D777838A3FE7F|ydcI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAACCAAAGCCTCCAA, downstream forward: _UP4_TAAAAGCACTGCTTACGAGC
  • BKK04780 (Δ[gene|A4DB115D36907DE3EE6F80738E4D777838A3FE7F|ydcI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAACCAAAGCCTCCAA, downstream forward: _UP4_TAAAAGCACTGCTTACGAGC
  • References

  • 22517742,22383849