SubtiBank SubtiBank
ydcI [2018-12-03 16:59:14]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydcI [2018-12-03 16:59:14]

unknown
locus
BSU04780
pI
6.77
mw
81.23 kDa
protein length
719 aa Sequence Blast
gene length
2157 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.5|RNase/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    525,743 → 527,902

    The protein

    [SW|Domains]

  • [SW|S1 domain] (aa 646 ... 718) (according to the Interpro database)
  • Modification

  • phosphorylated on Arg-473 [Pubmed|22517742]
  • Structure

  • [PDB|2OCE] (the protein from Pseudomonas aeruginosa, 43% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|A4DB115D36907DE3EE6F80738E4D777838A3FE7F|ydcI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C101 (ydcI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2099 NBRP B. subtilis, Japan]
  • BKE04780 (Δ[gene|A4DB115D36907DE3EE6F80738E4D777838A3FE7F|ydcI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAACCAAAGCCTCCAA, downstream forward: _UP4_TAAAAGCACTGCTTACGAGC
  • BKK04780 (Δ[gene|A4DB115D36907DE3EE6F80738E4D777838A3FE7F|ydcI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAACCAAAGCCTCCAA, downstream forward: _UP4_TAAAAGCACTGCTTACGAGC
  • References

  • 22517742,22383849