SubtiBank SubtiBank
ydcI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydcI

similar to RNase
locus
BSU04780
pI
6.77
mw
81.23 kDa
protein length
719 aa Sequence Blast
gene length
2160 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.5|RNase/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    525,743 527,902

    The protein

    [SW|Domains]

  • [SW|YqgF/RNase H-like domain] (aa 321 ... 446) (according to the Interpro database)
  • [SW|S1 domain] (aa 646 ... 718) (according to the Interpro database)
  • Modification

  • phosphorylated on Arg-473 [Pubmed|22517742]
  • Structure

  • [PDB|2OCE] (the protein from Pseudomonas aeruginosa, 43% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|A4DB115D36907DE3EE6F80738E4D777838A3FE7F|ydcI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C101 (ydcI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2099 NBRP B. subtilis, Japan]
  • BKE04780 ([gene|A4DB115D36907DE3EE6F80738E4D777838A3FE7F|ydcI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAACCAAAGCCTCCAA, downstream forward: _UP4_TAAAAGCACTGCTTACGAGC
  • BKK04780 ([gene|A4DB115D36907DE3EE6F80738E4D777838A3FE7F|ydcI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAACCAAAGCCTCCAA, downstream forward: _UP4_TAAAAGCACTGCTTACGAGC
  • References

  • 22517742,22383849