SubtiBank SubtiBank
ywnF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywnF

unknown
locus
BSU36580
pI
10.20
mw
16.75 kDa
protein length
144 aa Sequence Blast
gene length
435 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,761,987 3,762,421

    Expression and Regulation

    Operons

    genes
    [gene|A4CF7E0BA2F1DD5E0BD7E6D750819812F6E0ECAC|ywnF]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A204 (ywnF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/204 NBRP B. subtilis, Japan]
  • BKE36580 ([gene|A4CF7E0BA2F1DD5E0BD7E6D750819812F6E0ECAC|ywnF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAATCCTCCCCCTTTA, downstream forward: _UP4_TAAAGAAGATCTGCACCCGG
  • BKK36580 ([gene|A4CF7E0BA2F1DD5E0BD7E6D750819812F6E0ECAC|ywnF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAATCCTCCCCCTTTA, downstream forward: _UP4_TAAAGAAGATCTGCACCCGG
  • References

  • 9353933