SubtiBank SubtiBank
cysI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cysI

sulfite reductase (NADPH2) (beta subunit)
locus
BSU_33430
pI
5.49
mw
64.63 kDa
protein length
571 aa Sequence Blast
gene length
1716 bp Sequence Blast
function
sulfite reduction
product
sulfite reductase (NADPH2)
essential
no
synonyms
yvgR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • Gene

    Coordinates
    3,430,598 3,432,313

    Phenotypes of a mutant

  • unable to grow with sulfate or sulfite as the only sulfur source [Pubmed|12169591]
  • The protein

    Catalyzed reaction/ biological activity

  • 3 H2O + hydrogen sulfide + 3 NADP+ --> 4 H+ + 3 NADPH + sulfite (according to UniProt)
  • Protein family

  • nitrite and sulfite reductase 4Fe-4S domain family (with [protein|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|NasD], according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • heme [pubmed|29852252]
  • Structure

  • [PDB|6C3M] (from E. coli, 52% identity) [pubmed|29852252]
  • Expression and Regulation

    Operons

    genes
    [gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]-[gene|5A99F57DF0DDF5A129C3702E97621232A8173C22|cysJ]
    description
    [Pubmed|12169591]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12169591], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL]: activation, [Pubmed|12169591], in [regulon|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL regulon]
  • regulation

  • induced by sulfite, sulfate, and thiosulfate ([protein|search|CysL]) [Pubmed|12169591]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B602 (yvgR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1601 NBRP B. subtilis, Japan]
  • 1A802 ( ''cysI''::''kan''), [Pubmed|11445163], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A802&Search=1A802 BGSC]
  • 1A934 ( ''cysI''::''kan''), [Pubmed|12169591], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A934&Search=1A934 BGSC]
  • BKE33430 (''[gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE33430 ([gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAAAAACTCCTTTC, downstream forward: _UP4_TGAGAAAGAAAGACGAGAGA
  • BKK33430 ([gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAAAAACTCCTTTC, downstream forward: _UP4_TGAGAAAGAAAGACGAGAGA
  • References

  • 12169591,12107147,11445163,29852252