SubtiBank SubtiBank
yugU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yugU

general stress protein, survival of ethanol and paraquat stresses
locus
BSU31280
pI
6.59
mw
16.17 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast
function
survival of stress conditions
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,213,854 3,214,252

    The protein

    Protein family

  • UPF0047 family (according to Swiss-Prot)
  • Structure

  • [PDB|1VMH] (the protein from ''Clostridium acetobutylicum'', 54% identity, 83% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|A4BF42889C55566ACE702561E34109F184413B85|yugU]-[gene|561B400C0255AAC2B52ADBBCA05D373E6366CD40|yuzH]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A616 (yugU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/616 NBRP B. subtilis, Japan]
  • BKE31280 ([gene|A4BF42889C55566ACE702561E34109F184413B85|yugU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTCTCCTTTCGTT, downstream forward: _UP4_TAATAGGCTGTTTTTTATGA
  • BKK31280 ([gene|A4BF42889C55566ACE702561E34109F184413B85|yugU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTCTCCTTTCGTT, downstream forward: _UP4_TAATAGGCTGTTTTTTATGA
  • References

  • 15805528,22582280