SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


general stress protein, survival of ethanol and paraquat stresses
16.17 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast
survival of stress conditions

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    3,213,854 3,214,252

    The protein

    Protein family

  • UPF0047 family (single member, according to UniProt)
  • Structure

  • [PDB|1VMH] (the protein from ''Clostridium acetobutylicum'', 54% identity, 83% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • view in new tab

    Biological materials


  • MGNA-A616 (yugU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31280 ([gene|A4BF42889C55566ACE702561E34109F184413B85|yugU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTCTCCTTTCGTT, downstream forward: _UP4_TAATAGGCTGTTTTTTATGA
  • BKK31280 ([gene|A4BF42889C55566ACE702561E34109F184413B85|yugU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTTTCTCCTTTCGTT, downstream forward: _UP4_TAATAGGCTGTTTTTTATGA
  • References

  • 15805528,22582280