thrR [2020-08-04 09:27:03]

transcription repressor of threonine biosynthetic genes

locus: BSU_27910

pI: 6.36

mw: 16.52 kDa

protein length: 147 aa

gene length: 444 bp

function: control of threonine biosynthesis

product: transcription repressor of threonine biosynthetic genes

essential: no

synonyms: pheB,yszB

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]

Gene

Coordinates: 2,852,157 2,852,600

The protein

Catalyzed reaction/ biological activity

• control of the threonine biosynthetic genes (''[gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]'' and ''[gene|548E92526BC00999031D6EDE43FE061CE0448AFC|thrD]'') [Pubmed|27260660]

Protein family

• UPF0735 family (single member, according to UniProt)

[SW|Domains]

• putative DNA binding signature (aa 19-51)
• [SW|ACT domain] (aa 70-145) (according to UniProt)

Effectors of protein activity

• lysine and cysteine (indirectly) inhibit DNA-binding activity of ThrR [Pubmed|27260660]

Expression and Regulation

Operons

• genes: [gene|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B]-[gene|84E7D672DB40B114DC4D96A4D8834958B47401A7|obg]-[gene|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]-[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]
  description: [Pubmed|22383849]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2537815], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  additional information

  • expression is repressed by binding of [SW|RpoE] to the A-rich sequence in the -35 region of the promoter [Pubmed|27679485]

Biological materials

Mutant

• BKE27910 (''[gene|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs) [Pubmed|27260660]
• BKE27910 ([gene|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATCCCCCCTTTAA, downstream forward: _UP4_GGTGCATAAGGGAGAGAAAA
• BKK27910 ([gene|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATCCCCCCTTTAA, downstream forward: _UP4_GGTGCATAAGGGAGAGAAAA

Expression vectors

• pGP2290: expression of ''thrR'' in B. subtilis (in[SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
• pBP323 (N-terminal Strep-tag, in [SW|pGP172]) (available in [SW|Fabian Commichau]'s lab) [Pubmed|27260660]
• pBP620 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Fabian Commichau]'s lab) [Pubmed|27260660]
• pBP622 (C-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP382]) (available in [SW|Fabian Commichau]'s lab) [Pubmed|27260660]

lacZ fusion

• pGP2291 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab [Pubmed|27260660]

labs

• [SW|Fabian Commichau] Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]

References

• 2537815,25777134,27260660