SubtiBank SubtiBank
thrR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thrR

transcription repressor of threonine biosynthetic genes
locus
BSU_27910
pI
6.36
mw
16.52 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
control of threonine biosynthesis
product
transcription repressor of threonine biosynthetic genes
essential
no
synonyms
pheB,yszB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,852,157 2,852,600

    The protein

    Catalyzed reaction/ biological activity

  • control of the threonine biosynthetic genes (''[gene|11421D5BD3AB6C205DDA0864F878E2B04340033F|hom]-[gene|4A839F8A53DF75DF01FE410EBD3361759C3B1C86|thrC]-[gene|290302BA8A4E44C62AE3071C1F7DE18B20605607|thrB]'' and ''[gene|548E92526BC00999031D6EDE43FE061CE0448AFC|thrD]'') [Pubmed|27260660]
  • Protein family

  • UPF0735 family (single member, according to UniProt)
  • [SW|Domains]

  • putative DNA binding signature (aa 19-51)
  • [SW|ACT domain] (aa 70 ... 145) (according to the Interpro database)
  • Effectors of protein activity

  • lysine and cysteine (indirectly) inhibit DNA-binding activity of ThrR [Pubmed|27260660]
  • Expression and Regulation

    Operons

    genes
    [gene|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B]-[gene|84E7D672DB40B114DC4D96A4D8834958B47401A7|obg]-[gene|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]-[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2537815], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • expression is repressed by binding of [SW|RpoE] to the A-rich sequence in the -35 region of the promoter [Pubmed|27679485]
  • view in new tab

    Biological materials

    Mutant

  • BKE27910 (''[gene|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs) [Pubmed|27260660]
  • BKE27910 ([gene|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATCCCCCCTTTAA, downstream forward: _UP4_GGTGCATAAGGGAGAGAAAA
  • BKK27910 ([gene|A4B7CF7A1C704C750AFAD97A43AF975260935083|thrR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATCCCCCCTTTAA, downstream forward: _UP4_GGTGCATAAGGGAGAGAAAA
  • Expression vectors

  • pGP2290: expression of ''thrR'' in B. subtilis (in[SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • pBP323 (N-terminal Strep-tag, in [SW|pGP172]) (available in [SW|Fabian Commichau]'s lab) [Pubmed|27260660]
  • pBP620 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Fabian Commichau]'s lab) [Pubmed|27260660]
  • pBP622 (C-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP382]) (available in [SW|Fabian Commichau]'s lab) [Pubmed|27260660]
  • lacZ fusion

  • pGP2291 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab [Pubmed|27260660]
  • labs

  • [SW|Fabian Commichau] Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
  • References

  • 2537815,25777134,27260660