SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


7.07 kDa
protein length
gene length
183 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    2,308,792 2,308,974

    Expression and Regulation


    expressed during [SW|sporulation] [Pubmed|22383849]
    view in new tab

    Biological materials


  • MGNA-B271 (ypeQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE21960 ([gene|A4B5C9A4BA04B0501766DADF19A49B67F92857C3|ypeQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTTATCCAATATCGTCATC, downstream forward: _UP4_TAAAAATAAAAACCGCAGAA
  • BKK21960 ([gene|A4B5C9A4BA04B0501766DADF19A49B67F92857C3|ypeQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTTATCCAATATCGTCATC, downstream forward: _UP4_TAAAAATAAAAACCGCAGAA