SubtiBank SubtiBank
ypeQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypeQ

unknown
locus
BSU_21960
pI
8.40
mw
7.07 kDa
protein length
gene length
183 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,308,792 2,308,974

    Expression and Regulation

    Operons

    genes
    [gene|1852AA40C48859202392834A3E791F6877DD3D30|ypeP]-[gene|A4B5C9A4BA04B0501766DADF19A49B67F92857C3|ypeQ]
    description
    [pubmed|22383849]
    regulation
    expressed during [SW|sporulation] [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B271 (ypeQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1270 NBRP B. subtilis, Japan]
  • BKE21960 ([gene|A4B5C9A4BA04B0501766DADF19A49B67F92857C3|ypeQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTTATCCAATATCGTCATC, downstream forward: _UP4_TAAAAATAAAAACCGCAGAA
  • BKK21960 ([gene|A4B5C9A4BA04B0501766DADF19A49B67F92857C3|ypeQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTTATCCAATATCGTCATC, downstream forward: _UP4_TAAAAATAAAAACCGCAGAA